|
Developmental Studies Hybridoma Bank
anti double stranded dsdna autoanti dsdna antibodies ![]() Anti Double Stranded Dsdna Autoanti Dsdna Antibodies, supplied by Developmental Studies Hybridoma Bank, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/double+stranded+dna/pmc12606421-61-6-14?v=Developmental+Studies+Hybridoma+Bank Average 93 stars, based on 1 article reviews
anti double stranded dsdna autoanti dsdna antibodies - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Worthington Biochemical
dnacellulose ![]() Dnacellulose, supplied by Worthington Biochemical, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/double+stranded+dna/10__1128_slash_jb__06003___11-81-36-37?v=Worthington+Biochemical Average 91 stars, based on 1 article reviews
dnacellulose - by Bioz Stars,
2026-08
91/100 stars
|
Buy from Supplier |
|
Bio X Cell
anti pd 1 monoclonal antibody ![]() Anti Pd 1 Monoclonal Antibody, supplied by Bio X Cell, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/double+stranded+dna/us12553029-5099-9-23?v=Bio+X+Cell Average 98 stars, based on 1 article reviews
anti pd 1 monoclonal antibody - by Bioz Stars,
2026-08
98/100 stars
|
Buy from Supplier |
|
Cusabio
dna dsdna ![]() Dna Dsdna, supplied by Cusabio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/double+stranded+dna/pmc13001939-106-8-10?v=Cusabio Average 93 stars, based on 1 article reviews
dna dsdna - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Boster Bio
mre11 ![]() Mre11, supplied by Boster Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/double+stranded+dna/pm41486457-247-54-55?v=Boster+Bio Average 90 stars, based on 1 article reviews
mre11 - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Boster Bio
anti dsba antibody ![]() Anti Dsba Antibody, supplied by Boster Bio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/double+stranded+dna/pmc12398576__42003_2025_8749_MOESM1_ESM-213-38-40?v=Boster+Bio Average 93 stars, based on 1 article reviews
anti dsba antibody - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Cusabio
sku dsd31 k01 ![]() Sku Dsd31 K01, supplied by Cusabio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/double+stranded+dna/pm37062567-116-74-76?v=Cusabio Average 93 stars, based on 1 article reviews
sku dsd31 k01 - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Cusabio
mouse anti dsdna elisa kit ![]() Mouse Anti Dsdna Elisa Kit, supplied by Cusabio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/double+stranded+dna/pmc08553505-80-7-11?v=Cusabio Average 93 stars, based on 1 article reviews
mouse anti dsdna elisa kit - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Boster Bio
antibodies to ku80 pb9464 ![]() Antibodies To Ku80 Pb9464, supplied by Boster Bio, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/double+stranded+dna/pm37390710-118-29-38?v=Boster+Bio Average 92 stars, based on 1 article reviews
antibodies to ku80 pb9464 - by Bioz Stars,
2026-08
92/100 stars
|
Buy from Supplier |
|
Boster Bio
monoclonal antibody ![]() Monoclonal Antibody, supplied by Boster Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/double+stranded+dna/pmc03406497-44-18-20?v=Boster+Bio Average 90 stars, based on 1 article reviews
monoclonal antibody - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Boster Bio
anti rabbit secondary antibody ![]() Anti Rabbit Secondary Antibody, supplied by Boster Bio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/double+stranded+dna/pm24604116-39-8-12?v=Boster+Bio Average 93 stars, based on 1 article reviews
anti rabbit secondary antibody - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Promega
59-biotinylated, mutant form of the e2f double-stranded dna binding site (e2fmut: biotin-59gatctagttttcgatattaaatttga-39) ![]() 59 Biotinylated, Mutant Form Of The E2f Double Stranded Dna Binding Site (E2fmut: Biotin 59gatctagttttcgatattaaatttga 39), supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/double+stranded+dna/10__1074_slash_jbc__273__37__23659-102-19-39?v=Promega Average 90 stars, based on 1 article reviews
59-biotinylated, mutant form of the e2f double-stranded dna binding site (e2fmut: biotin-59gatctagttttcgatattaaatttga-39) - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Genetics
Article Title: A novel role for the E2F transcription factor and the ER stress sensor IRE1 in cytoplasmic DNA accumulation
doi: 10.1093/genetics/iyaf190
Figure Lengend Snippet: DNA accumulates in the cytoplasm of de2f1b SGs. a) Control ( w 1118 ) and de2f1b SGs ( de2f1b/Df ) are stained with an antibody against double-stranded DNA (anti-dsDNA) and DAPI. Lower panels show magnified views of the box area (scale bars: 50 and 20 μm for magnified images). Arrowheads mark anti-dsDNA signals that overlap with cytoplasmic DAPI. b) de2f1b SGs expressing mitochondrially localized GFP (Mito-GFP) are stained with anti-dsDNA. Arrowheads mark anti-dsDNA signals that overlap with cytoplasmic DAPI and asterisks indicate anti-dsDNA signals that demark mitochondria (scale bars: 10 μm) (c) Antimicrobial peptide gene (AMP) expression levels were measured by RT-qPCR. Relative fold difference of indicated AMPs between control and de2f1b SGs are shown (**** P < 0.0001, *** P < 0.001, ** P < 0.01, * P < 0.05). d) The relative fold differences of the expression of previously identified STING-regulated genes between control and de2f1b SGs is determined by RT-qPCR (**** P < 0.0001).
Article Snippet: The anti- γ H2Av (UNC93-5.2.1) and
Techniques: Control, Staining, Expressing, Quantitative RT-PCR
Journal: Genetics
Article Title: A novel role for the E2F transcription factor and the ER stress sensor IRE1 in cytoplasmic DNA accumulation
doi: 10.1093/genetics/iyaf190
Figure Lengend Snippet: The endoplasmic reticulum (ER) homeostasis is deregulated in de2f1b SGs. a) RNA-seq was performed to compare the gene expression profile between control and de2f1b SGs. Volcano plot of differentially expressed genes in de2f1b SGs is shown. Each point represents a gene plotted by log 2 fold change (x-axis) and –log 10 adjusted P -value ( y -axis). Significantly upregulated and significantly downregulated genes are shown (genes with adjusted P -value < 0.05). Five genes that belongs to the category “protein processing in the ER” are highlighted and labeled. b) Ontology analysis was performed with genes whose expressions are downregulated in de2f1b SGs. The top 5 biological processes identified from the ontology analysis are shown. The intensity of the color depicts the false discovery rate, and the size of the circles depicts the fold enrichment. c) A GFP construct tagged with ER localization and retention signals is used to visualize ER morphology (ER:GFP). Anti-dsDNA was also used to determine the abundance of cytoDNA. Magnified view of the boxed area is also shown (scale bars: 50 and 25 μm for magnified images). (d) A genomic construct, in which the coding region of the SGS3 gene is fused with the GFP sequence (SGS:GFP), is used to monitor the expression of “glue proteins” in control and de2f1b SGs. Anti-dsDNA was also used to determine the abundance of cytoDNA. White arrowheads point to cells with a high level of cytoDNA (scale bars: 50 and 25 μm for magnified images). FB: Fat body.
Article Snippet: The anti- γ H2Av (UNC93-5.2.1) and
Techniques: RNA Sequencing, Gene Expression, Control, Labeling, Construct, Sequencing, Expressing
Journal: Genetics
Article Title: A novel role for the E2F transcription factor and the ER stress sensor IRE1 in cytoplasmic DNA accumulation
doi: 10.1093/genetics/iyaf190
Figure Lengend Snippet: IRE-1 is required for proper ER development and preventing cytoDNA accumulation. a) Ire1 was depleted in the SG and their effect on the ER was visualized by ER-localized GFP (ER:GFP). A control SG ( sg-G4 ) and a representative image of ire1 -depleted SGs are shown ( sg-G4 > ire1 RNAi ). b) Xbp1 was depleted in the SG ( sg-G4 > xbp1 RNAi ) and their effect on the ER network was visualized. c) Ire1 was depleted in the SG ( sg-G4 > ire1 RNAi ) and cytoDNA was visualized by anti-dsDNA. d) The SGS:GFP genomic construct was used to monitor the expression of glue proteins in control and ire-1 depleted SGs at 110–120 h AEL. cytoDNA was also visualized by anti-dsDNA (scale bars for all the images: 50 and 20 μm for magnified images).
Article Snippet: The anti- γ H2Av (UNC93-5.2.1) and
Techniques: Control, Construct, Expressing
Journal: Genetics
Article Title: A novel role for the E2F transcription factor and the ER stress sensor IRE1 in cytoplasmic DNA accumulation
doi: 10.1093/genetics/iyaf190
Figure Lengend Snippet: IRE1 overexpression differently affects the ER in de2f1b SGs. a) XBP1 or IRE1 was overexpressed in control ( sg-G4 ) and de2f1b SGs ( sg-G4; de2f1b/Df ), and the ER was visualized by ER:GFP. Magnified images of the boxed area are shown in the lower panels. b) The effect of overexpressing XBP1 or IRE1 on cytoDNA accumulation in wild-type SGs is determined. The presence of cytoDNA was visualized by anti-dsDNA. Arrowheads point to cytoDNA. Magnified images of the boxed area are shown in the lower panels (scale bars for all the images: 50 and 20 μm for magnified images).
Article Snippet: The anti- γ H2Av (UNC93-5.2.1) and
Techniques: Over Expression, Control
Journal: PLOS One
Article Title: GBP2 promotes podocyte pyroptosis and contributes to the pathogenesis of pediatric lupus nephritis
doi: 10.1371/journal.pone.0344601
Figure Lengend Snippet: A Evaluation of urinary protein-creatinine ratio, kidney-to-body weight ratio, blood urea nitrogen and anti-dsDNA antibody levels in control and Lupus nephritis (LN) mice. B Representative immunohistochemical staining of renal tissues in control and LN mice (400 × magnification; scale bar, 50 μm). C Evaluation of pyroptosis-related mRNA levels by RT-qPCR. D Evaluation of pyroptosis-related protein levels by western blotting. Data were expressed as the mean ± SD (n = 6 per group). * P < 0.05, ** P < 0.01, *** P < 0.001.
Article Snippet: Following the manufacturer’s protocol, the concentrations of double-stranded
Techniques: Control, Immunohistochemical staining, Staining, Quantitative RT-PCR, Western Blot
Journal: Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie
Article Title: Quercetin inhibits DNA damage responses to induce apoptosis via SIRT5/PI3K/AKT pathway in non-small cell lung cancer.
doi: 10.1016/j.biopha.2023.115071
Figure Lengend Snippet: Fig. 5. Quercetin inhibited NHEJ and HR pathways phosphorylation. Total proteins lysis and extraction after A549 and H1299 cultured with 0, 12.5, 50, and 200 μM quercetin for 24 h. In NHEJ pathways (A) the expression of p-DNA-PKcsS2056 (B, C), KU70 (D, E) and KU80 (F, G), and in HR pathways (H) the phosphorylation of p- ATRS428 (I, J), p-Chek1S345 (K, L), p-ATMS1981 (M, N) and Chek2T68 (O, P) were detected by western blot in both A549 and H1299 cells. And the results were measured by ImageJ and expressed as protein expression relative to GAPDH (mean ± S.D., n = 3). #p > 0.05, *p < 0.05, * *p < 0.01, * **p < 0.001 relative to values in the respective 0 μM group (B, p = 0.0048, R2 =0.7844, F=9.700; C, p = 0.0002, R2 =0.9042, F=25.17; D, p = 0.0054, R2 =0.7782, F=9.358; E, p = 0.0045, R2 =0.7879, F=9.908; F, p = 0.0037, R2 =0.7990, F=10.60; G, p = 0.0016, R2 =0.8379, F=13.79; I, p = 0.0034, R2 =0.8028, F=10.85; J, p = 0.0032, R2 =0.8066, F=11.12; K, p = 0.0010, R2 =0.8564, F=15.91; L, p = 0.0016, R2 =0.8379, F=13.79; M, p = 0.0044, R2 =0.7898, F=10.02; N, p = 0.0065, R2 =0.7676, F=8.806; O, p = 0.0030, R2 =0.0.8087, F=11.27; P, p = 0.0026, R2 =0.8166, F=11.87), One-way ANOVA test. The mRNA in A549 (Q) and H1299 (R) cells was extracted and reverse transcribed to cDNA for RT-qPCR analysis (mean ± S.D., n = 3). #p > 0.05, *p < 0.05, * *p < 0.01, * **p < 0.001, * ** *p < 0.0001 relative to values in the respective 0 μM group, One-way ANOVA test.
Article Snippet: Antibodies to γ-H2AXS139, p-ATRS428 (AP0676) and p-CDK1T161 (AP0324) were from Abclonal Technology (Abclonal, Wuhan, China); antibodies to KU70 (AF0300) and p-Chek1Ser345 (AF3008) were from Affinity Biosciences (Affinity, Jiangsu, China);
Techniques: Phospho-proteomics, Lysis, Extraction, Cell Culture, Expressing, Western Blot, Reverse Transcription, Quantitative RT-PCR